CAGEscan mapping protocol
From Wiki
Jump to navigationJump to search
Sample splitting and linker removal
Input is 5′ and 3′ paired-end fastq files from the Illumina sequencers.
- The 9 first bases of the 5′ reads are trimmed. The 6 first are the index sequence (“barcode”) and the 3 next are the linker (
GGG).
- The 6 first bases of the 3′ reads are trimmed because they derive from to the random part (N6) of the reverse-transcription primer, and therefore may not reflect the RNA sequences accurately, since the reverse-transcriptase tolerates mismatches even on the last two bases. See Mizuno et al., 1999 for example of priming over mismatches.
We use the in-house command PipelinePairedEndExtraction.pl. It generates pairs of FASTQ files (5′ and 3′).
Artefact filtering
Each FASTQ file is filtered with TagDust, using an empty construct as library sequences:
AATGATACGGCGACCACCGAGATCTACACTAGTCGAACTGAAGGTCTCCAGCA[barcode]gggAGATCGGAAGAGCGGTTCAGCAGGAATGCCGAGACCGATCTCGTATGCCGTCTTCTGCTTG
Removal of rDNA sequences
Each FASTQ file is filtered again to remove reads that match the ribosomal DNA repeated unit (rDNA), with the program rRNAdust.
Final Output
Mapped paired-end tags in BAM format
