CAGEscan mapping protocol

Sample splitting and linker removal

Input is 5′ and 3′ paired-end fastq files from the Illumina sequencers.

• The 9 first bases of the 5′ reads are trimmed. The 6 first are the index sequence (“barcode”) and the 3 next are the linker (GGG).

• The 6 first bases of the 3′ reads are trimmed because they derive from to the random part (N6) of the reverse-transcription primer, and therefore may not reflect the RNA sequences accurately, since the reverse-transcriptase tolerates mismatches even on the last two bases. See Mizuno et al., 1999 for example of priming over mismatches.

We use the in-house command PipelinePairedEndExtraction.pl. It generates pairs of FASTQ files (5′ and 3′).

Artefact filtering

Each FASTQ file is filtered with TagDust, using an empty construct as library sequences:

AATGATACGGCGACCACCGAGATCTACACTAGTCGAACTGAAGGTCTCCAGCA[barcode]gggAGATCGGAAGAGCGGTTCAGCAGGAATGCCGAGACCGATCTCGTATGCCGTCTTCTGCTTG

Final Output

Mapped paired-end tags in BAM format