OP-SOLEXA-5RACE-v1.0

Protocol: OP-SOLEXA-5RACE-v1.0

Author: Plessy, Charles

Created: June 23rd, 2009

Update: June 23rd, 2009

Parameters:

Description:

Gene models of interest were retrieved from the NCBI Reference Sequence collection [1]. The fist 200 bases from their transcript sequence was extracted and prepended with the sequence of the 5' RACE adapter [2] of the Ambion FirstChoice RLM-RACE kit [3] using the European Molecular Biology Open Software Suite [4]. Nested PCR primers were picked using Primer3 [5] and EMBOSS with the following parameters: -maxtm 70 -mintm 60 -otm 65 -minsize 20 -maxsize 28 (outer) or 35 (inner) -osize 24 -productosize 135 (outer) or 80 (inner) -productsizerange 100-200 (outer) or 55-120 (inner) -forwardinput GCTGATGGCGATGAATGAACACTG (outer) or AACACTGCGTTTGCTGGCTTTGATG (inner), using the mispriming library 'rodrep_and_simple.fasta' available for download on the Primer3 Internet site. Inner PCR primers were prepended with an Illumina Genome Analyzer II flow-cell sequence [6] to prepare products for deep sequencing.

5' Deep-RACE-PCR was performed as in Olivarius et al, 2009 [7]. In brief, 10 micrograms of total RNA were dephosphorylated with calf Intestinal phosphatase, decapped with tobacco acid pyrophosphatase, ligated to a RNA adaptor with T4 RNA ligase 1, and first-strand cDNAs were synthethised with MMLV reverse-transcriptase and random decamers using the Ambion FirstChoice RLM-RACE kit, and following the manufacturer's instructions. Nested PCR was performed with TaKaRa Ex Taq [8] following the instructions of the FirstChoice kit using the primers designed as above. PCR products were purified with a Qiagen QIAquick PCR Purification Kit [9] and sequenced in a Illumina Genome Analyzer II with a custom sequencing primer [10].

[1] Pruitt, KD., Tatusova, T. and Maglott, DR. (2007). NCBI reference sequences (RefSeq): a curated non-redundant sequence database of genomes, transcripts and proteins. Nucleic Acids Res. 35, D61-5.

[2] GCTGATGGCGATGAATGAACACTGCGTTTGCTGGCTTTGATGAAA

[3] Cat. Num. AM1700

[4] Rice P, Longden I, Bleasby A. (2000). EMBOSS: the European Molecular Biology Open Software Suite. Trends Genet. 2000 Jun;16(6):276-7.

[5] Rozen S, Skaletsky H. (2000). Primer3 on the WWW for general users and for biologist programmers. Methods Mol Biol. 2000;132:365-86.

[6] CAAGCAGAAGACGGCATACGA

[7] Olivarius S, Plessy C, Carninci P. High-throughput verification of transcriptional starting sites by Deep-RACE. Biotechniques. 2009 Feb;46(2):130-2.

[8] Cat. Num. RR001A

[9] Cat. Num. 28104

[10] GACCACCGAACACTGCGTTTGCTGGCTTTGATG